View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13954_high_7 (Length: 295)
Name: NF13954_high_7
Description: NF13954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13954_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 10002376 - 10002655
Alignment:
| Q |
1 |
aactgtggaaggatggtacaaatcacaatagttgattacaaatcggtcatttttataatacattaaggatttcaaactgaatttgggaaagccaaagaca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10002376 |
aactgtggaaggctggtacaaatcacaatagttgattataaatcggtcatttttataatacgttaaggatttcaaactgaatttgggaaagccaaagaca |
10002475 |
T |
 |
| Q |
101 |
aaacttcatttaggatagctggcacaaaactgcattagggataggcaaggtcagactttatccgagatattaattcagtgtgtatctcactggtgaaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10002476 |
aaacttcatttaggatagctggcacaaaactgcattagggataggcaaggtcagactttatccgagatattaattcagtgtgtatctcactggtgaaata |
10002575 |
T |
 |
| Q |
201 |
ggagaaatcaccattggtattaattcacaataggaggcttttataaaaggcaattgaatcacacctaaccctaagtttat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10002576 |
ggagaaatcaccattggtattaattcacaataggaggcttttataaaaggcaattgaatcacacctaaccctaagtttat |
10002655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University