View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13955_high_56 (Length: 265)
Name: NF13955_high_56
Description: NF13955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13955_high_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 186 - 248
Target Start/End: Complemental strand, 10935415 - 10935353
Alignment:
| Q |
186 |
cacaaaatcaaaccgatgcaaatagagaaattgataaagaacgagagtttgagcgcacagaac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||| |
|
|
| T |
10935415 |
cacaaaatcaaaccgatgcaaatagagaaattgataaagaacgagactttcagctcacagaac |
10935353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 121
Target Start/End: Complemental strand, 10935522 - 10935480
Alignment:
| Q |
79 |
atcctcaaaaaacacaattaaatcaacccaaattcttttatcc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
10935522 |
atcctcaaaaaacacaattaaatcaacccacaatcttttatcc |
10935480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University