View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13955_low_21 (Length: 455)
Name: NF13955_low_21
Description: NF13955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13955_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 18 - 290
Target Start/End: Complemental strand, 9221986 - 9221714
Alignment:
| Q |
18 |
catcaaatgaaa-gggggaccaaaattttatgattagaaatagggggagcaaaacggcggttttcccaaaatagaaggatgaaaacaacaatttaaatca |
116 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9221986 |
catcaaatgaaacgggggaccaaaattctatgattagaaatagggggagcaaaacggcggttttcccaaaatagaaggatgaaaacaaca-tttaaatca |
9221888 |
T |
 |
| Q |
117 |
ttgtggtttttcaactaatcaagatttcttacagtttaatgacatacatttttgtgcctaattcaggaatattgatatgtttatggagccattgctcttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9221887 |
ttgtggtttttcaactaatcaagattgcttacagtttaatgacatacatttttgtgcctaattcaggaatattgatatgtttatggagccattgctcttc |
9221788 |
T |
 |
| Q |
217 |
ttggaacccttcatgagactggtatgcaaccatttctgttaacatgaataatgttgtaaaattaatgaatatat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
9221787 |
ttggaacccttcatgagactggtatgcaactatttctgttaacatgaataatgttataaaatgaatgaatatat |
9221714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 327 - 446
Target Start/End: Complemental strand, 9221675 - 9221556
Alignment:
| Q |
327 |
atgtgtcccctgatgcagaaaatgaaggcaagtgtccaagagatcttgaagataagttcattaacaggatcagaatatgggaataagggaaaaagaattg |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9221675 |
atgtgtcccctgatgcagaaaatgaaggcaagtgtccaagagatcttgaagataagttcattaacaggatcagaatatgggaataagggaaaaagaattg |
9221576 |
T |
 |
| Q |
427 |
tgcttgctgtgatatctctg |
446 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
9221575 |
tgcttgctgtgatatctctg |
9221556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University