View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13955_low_23 (Length: 447)

Name: NF13955_low_23
Description: NF13955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13955_low_23
NF13955_low_23
[»] chr5 (1 HSPs)
chr5 (377-430)||(33118382-33118435)
[»] chr2 (2 HSPs)
chr2 (307-397)||(21560656-21560746)
chr2 (308-392)||(21493487-21493571)


Alignment Details
Target: chr5 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 377 - 430
Target Start/End: Original strand, 33118382 - 33118435
Alignment:
377 atgatcggtttggaaggaaaattacaatcctttatgcagatggactattctttg 430  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33118382 atgatcggtttggaaggaaaattacaatcctttatgcagatggactattctttg 33118435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 5e-20; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 397
Target Start/End: Complemental strand, 21560746 - 21560656
Alignment:
307 aaacaggaagcaatagtgagtacagcaattgctggtgcaattataggagcttcaggtggtggatggatgaatgatcggtttggaaggaaaa 397  Q
    ||||||||||| ||||||||||||||| ||||||| ||||| ||||| || |||| |||||||||||| || ||||| |||||||||||||    
21560746 aaacaggaagccatagtgagtacagcacttgctggagcaatcataggtgcatcagttggtggatggatcaacgatcgatttggaaggaaaa 21560656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 308 - 392
Target Start/End: Complemental strand, 21493571 - 21493487
Alignment:
308 aacaggaagcaatagtgagtacagcaattgctggtgcaattataggagcttcaggtggtggatggatgaatgatcggtttggaag 392  Q
    |||||||||| ||||||||||||||||||||||| |||||||| |||||| ||  ||| |||||||| |||||| ||||||||||    
21493571 aacaggaagccatagtgagtacagcaattgctggagcaattattggagctgcaattggaggatggatcaatgataggtttggaag 21493487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University