View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13955_low_23 (Length: 447)
Name: NF13955_low_23
Description: NF13955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13955_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 377 - 430
Target Start/End: Original strand, 33118382 - 33118435
Alignment:
| Q |
377 |
atgatcggtttggaaggaaaattacaatcctttatgcagatggactattctttg |
430 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33118382 |
atgatcggtttggaaggaaaattacaatcctttatgcagatggactattctttg |
33118435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 5e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 307 - 397
Target Start/End: Complemental strand, 21560746 - 21560656
Alignment:
| Q |
307 |
aaacaggaagcaatagtgagtacagcaattgctggtgcaattataggagcttcaggtggtggatggatgaatgatcggtttggaaggaaaa |
397 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| ||||| ||||| || |||| |||||||||||| || ||||| ||||||||||||| |
|
|
| T |
21560746 |
aaacaggaagccatagtgagtacagcacttgctggagcaatcataggtgcatcagttggtggatggatcaacgatcgatttggaaggaaaa |
21560656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 308 - 392
Target Start/End: Complemental strand, 21493571 - 21493487
Alignment:
| Q |
308 |
aacaggaagcaatagtgagtacagcaattgctggtgcaattataggagcttcaggtggtggatggatgaatgatcggtttggaag |
392 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||| |||||| || ||| |||||||| |||||| |||||||||| |
|
|
| T |
21493571 |
aacaggaagccatagtgagtacagcaattgctggagcaattattggagctgcaattggaggatggatcaatgataggtttggaag |
21493487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University