View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13955_low_30 (Length: 427)
Name: NF13955_low_30
Description: NF13955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13955_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 246
Target Start/End: Original strand, 7381079 - 7381308
Alignment:
| Q |
17 |
caagttcttgtctttgtctctctttcaactacccttttgggaattcccatgcaaaaaagcttcttggttagttttgtgagatcattaagtatattttttc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7381079 |
caagttcttgtctttgtctctctttcaactacccttttgggaattcccatgcaaaaaagcttcttggttagttttgtaagatcattaagtatattttttc |
7381178 |
T |
|
| Q |
117 |
aaggcttgtggcttatggttatggggtacatgctttggacaccaagtttgattgccaaagggtgttttatgaattctgaagaaggacataaagttgtgag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381179 |
aaggcttgtggcttatggttatggggtacatgctttggacaccaagtttaattgccaaagggtgttttatgaattctgaagaaggacataaagttgtgag |
7381278 |
T |
|
| Q |
217 |
atgttctgatgaagaatcacttcatcgtgc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7381279 |
atgttctgatgaagaatcacttcatcgtgc |
7381308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 326 - 417
Target Start/End: Original strand, 7381388 - 7381479
Alignment:
| Q |
326 |
accaaatattatggtgcaaataaagttcggtatttctcgttggggattgaggatgaagagagagaagatgttgaaaagttaagtgatgatgt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381388 |
accaaatattatggtgcaaataaagttcggtatttctcgttggggattgaggatgaagagagagaagatgttgaaaagttaagtgatgatgt |
7381479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University