View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13955_low_65 (Length: 243)
Name: NF13955_low_65
Description: NF13955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13955_low_65 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 243
Target Start/End: Complemental strand, 55932611 - 55932380
Alignment:
| Q |
12 |
aagaaccattctagggaggcattgaggctatttgatgaaatgcaactggctaaattggacagtgttattcatgaacctcatagaaagaggatgaattatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55932611 |
aagaaccattctagggaggcattgaggctatttgatgaaatgcaactggctaaattggacagtgttattcatgaacctcatagaaagaggatgaattatt |
55932512 |
T |
 |
| Q |
112 |
caaatattcagaaagtcttaggatgtagctcaactgaagttgatcgtgaacttcatgannnnnnnctggagataattcacaaccaaaatccttcgagata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55932511 |
caaatattcagaaagtcttaggatgtagctcaactgaagttgatcgtgaacttcatgatttttttctggagataattcacaaccaaaatccttcgagata |
55932412 |
T |
 |
| Q |
212 |
tttgaaacgtcgaataatatacttggcaggat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55932411 |
tttgaaacgtcgaataatatacttggcaggat |
55932380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University