View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13955_low_71 (Length: 212)
Name: NF13955_low_71
Description: NF13955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13955_low_71 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 22 - 194
Target Start/End: Original strand, 10311 - 10483
Alignment:
| Q |
22 |
tatgtatcctctggatttataatataagaattgtgtgataaattttaacatctttattgtagatcttgcttgaaatatatgatatgctcttaaggatgta |
121 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10311 |
tatgtatcctatggatttataatataagaattgtgtgataaattttaacatctttattgtagatcttgcttgaaatatatgatatgctcttaaggatgta |
10410 |
T |
 |
| Q |
122 |
gttttgtcaatcacctcccttttgaaatatggagtattaaattactattttttaccttttagattttgtagta |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10411 |
gttttgtcaatcacctcccttttgaaatatggagtattaaattactattttttaccttttagattttgtagta |
10483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University