View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13958_low_2 (Length: 229)
Name: NF13958_low_2
Description: NF13958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13958_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 47 - 212
Target Start/End: Complemental strand, 29710795 - 29710643
Alignment:
| Q |
47 |
atgctcatctctttcaaaatagatacatctttagaggtgttgaccaaacgttttccattttctttcatctaatgttagaattttgtgttagtcctcgaat |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29710795 |
atgctcatctctttcaaaatagatacatctttagaggtgttgaccaaacgttttccattttctttcatctaatgttag-------------tcctcgaat |
29710709 |
T |
|
| Q |
147 |
gatatccaaatatccaaatcagaatgcagattcacgtgcttcaggataatagttgtataatctatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29710708 |
gatatccaaatatccaaatcagaatgcagattcacgtgcttcaggataatagttgtataatctatc |
29710643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University