View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13959_high_2 (Length: 253)
Name: NF13959_high_2
Description: NF13959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13959_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 70 - 156
Target Start/End: Complemental strand, 30181031 - 30180945
Alignment:
| Q |
70 |
aaccatactattactttcttcagtccttaaccatacgaagttaaaatgatttctcatgttttaaatagtaacatttaattttacaaa |
156 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30181031 |
aaccatactgttactttcttcagtcattaaccatacgaagctaaaatgatttctcatgttttacatagtaacatttaattttacaaa |
30180945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 148 - 228
Target Start/End: Complemental strand, 30180742 - 30180662
Alignment:
| Q |
148 |
ttttacaaattcaattttatattgtgctctcacattttgagtatctttgttatagtgagttaattatccatgtacaaatat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
30180742 |
ttttacaaattcaattttatattgtgctctcacattttgaatagctgtgttataatgagttaattatccatgtacaaatat |
30180662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 205 - 243
Target Start/End: Original strand, 30781387 - 30781425
Alignment:
| Q |
205 |
agttaattatccatgtacaaatatccattataccctatg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30781387 |
agttaattatccatgtacaaatatccattataccctatg |
30781425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 45
Target Start/End: Complemental strand, 30181087 - 30181055
Alignment:
| Q |
13 |
tgcatgttcatcattggaccgcattaagttgtt |
45 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
30181087 |
tgcatgttcatcattggactgcattaagttgtt |
30181055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University