View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13959_low_5 (Length: 244)
Name: NF13959_low_5
Description: NF13959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13959_low_5 |
 |  |
|
| [»] scaffold0403 (1 HSPs) |
 |  |  |
|
| [»] scaffold0298 (1 HSPs) |
 |  |  |
|
| [»] scaffold0261 (2 HSPs) |
 |  |  |
|
| [»] scaffold0165 (1 HSPs) |
 |  |  |
|
| [»] scaffold0149 (2 HSPs) |
 |  |  |
|
| [»] scaffold0108 (1 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 45175447 - 45175389
Alignment:
| Q |
170 |
tgattgtgtacatgttgacgaaatcagctcactttataccactgcaaactaactataat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45175447 |
tgattgtgtacatgttgacgaaatcagctcactttataccactgcaaactaactataat |
45175389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 101
Target Start/End: Complemental strand, 45175489 - 45175456
Alignment:
| Q |
68 |
ggacaacatttccatggacttcgttggtgctacc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45175489 |
ggacaacatttccatggacttcgttggtgctacc |
45175456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 15078456 - 15078419
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15078456 |
gatgtgccagagtggaagtgggacaacatttccatgga |
15078419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 133 - 224
Target Start/End: Complemental strand, 17854431 - 17854342
Alignment:
| Q |
133 |
ctaccaaagactcagagaaagtttgactctatatgggtgattgtgtacatgttgacgaaatcagctcactttataccactgcaaactaacta |
224 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||| |||| ||| ||| ||||||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
17854431 |
ctaccaaaaactcagaggaagtttgactctatatggatgatcgtggacaagttgacg--atcagctcactttataccactacgaactaacta |
17854342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Original strand, 21125150 - 21125187
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21125150 |
gatgtgccagagtggaagtgggacaacatttccatgga |
21125187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0403 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0403
Description:
Target: scaffold0403; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 3643 - 3606
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3643 |
gatgtgccggagtggaagtgggacaacatttccatgga |
3606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 23655814 - 23655777
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23655814 |
gatgtgccggagtggaagtgggacaacatttccatgga |
23655777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Original strand, 20009813 - 20009850
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20009813 |
gatgtgccagagtggaagtgggacaacatttccatgga |
20009850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 21841304 - 21841267
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21841304 |
gatgtgccagagtggaagtgggacaacatttccatgga |
21841267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 22371827 - 22371790
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22371827 |
gatgtgcctgagtggaagtgggacaacatttccatgga |
22371790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0298 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0298
Description:
Target: scaffold0298; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 85
Target Start/End: Complemental strand, 20837 - 20798
Alignment:
| Q |
46 |
tggatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
20837 |
tggatgtgccggagtggaagtgggacaacatttctatgga |
20798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0261 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0261
Description:
Target: scaffold0261; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 85
Target Start/End: Original strand, 14649 - 14688
Alignment:
| Q |
46 |
tggatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
14649 |
tggatgtgccggagtggaagtgggacaacatttctatgga |
14688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0261; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 85
Target Start/End: Original strand, 22828 - 22867
Alignment:
| Q |
46 |
tggatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
22828 |
tggatgtgccggagtggaagtgggacaacatttctatgga |
22867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 85
Target Start/End: Original strand, 15102039 - 15102078
Alignment:
| Q |
46 |
tggatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
15102039 |
tggatgtgccggagtggaagtgggacaacatttctatgga |
15102078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 85
Target Start/End: Original strand, 11303450 - 11303489
Alignment:
| Q |
46 |
tggatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
11303450 |
tggatgtgccggagtggaagtgggacaacatttctatgga |
11303489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Original strand, 16827882 - 16827919
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16827882 |
gatgtgccagagtggaagtgggacaacatttccatgga |
16827919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0165 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0165
Description:
Target: scaffold0165; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 5282 - 5245
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
5282 |
gatgtgccatagtggaagtgggacaacatctccatgga |
5245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0149 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: scaffold0149
Description:
Target: scaffold0149; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Original strand, 6690 - 6727
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
6690 |
gatgtgccggagtggaagtgggacagcatttccatgga |
6727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0149; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Original strand, 11121 - 11158
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
11121 |
gatgtgccggagtggaagtgggacagcatttccatgga |
11158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0108 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0108
Description:
Target: scaffold0108; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 47976 - 47939
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47976 |
gatgtgccagagtggaagtgggacaacatttccatgga |
47939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 40590 - 40553
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40590 |
gatgtgccagagtggaagtgggacaacatttccatgga |
40553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 28909 - 28872
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28909 |
gatgtgccagagtggaagtgggacaacatttccatgga |
28872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Original strand, 21890392 - 21890429
Alignment:
| Q |
48 |
gatgtgccgtagtggaagtgggacaacatttccatgga |
85 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21890392 |
gatgtgccagagtggaagtgggacaacatttccatgga |
21890429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University