View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_high_16 (Length: 250)
Name: NF1395_high_16
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 6112898 - 6112662
Alignment:
| Q |
1 |
tagttccagctaagccacatctctagactctaatgaaacgaacttgtcactccacctggctataccgataaaatccatagcaataagtaaggcaaatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6112898 |
tagttccagctaagccacatctctagactctaatgaaacgaacttgtcactccacctggctataccgataaaatccatagcaataagtaaggcaaatcca |
6112799 |
T |
 |
| Q |
101 |
taacagatgtaacctggccctggcagctttggnnnnnnnntattgaattaccataaatgtgaggcgtgataacagtaatatttgctgcaacaaaaaatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6112798 |
taacagatgtaacctggccctggcagctttggaaaaaaaatattgaattaccataaatgtgaggcgtgataacagtaatatttgctgcaacaaaaaatgg |
6112699 |
T |
 |
| Q |
201 |
ctgccaagctacagttaacgctcccaaactgccccct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6112698 |
ctgccaagctacagttaacgctcccaaactgccccct |
6112662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University