View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_high_4 (Length: 344)
Name: NF1395_high_4
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 16 - 313
Target Start/End: Original strand, 2631552 - 2631843
Alignment:
| Q |
16 |
atcgtgaagtcctactctacaagtaacaaatatggccccgttgcatttaagatgacattaaattcaacaagtggtcaaatttcaccatcatggtgccagt |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2631552 |
atcgtgaagtccaactctacaagtaacaaatatggccccgttgcatttaagatgacattaaat-caacaagtggtcaaatttcaccatcatggtgccagt |
2631650 |
T |
 |
| Q |
116 |
gccatttttccacggcactatggtatggtaggtagaaccttatggtatgtatgtaccatcatatgcagatgaatgtcaaaaagaaaaagagatagagttg |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2631651 |
gccatttttccacggcactatg-----gtaggtagaaccttatggtatgtatgtaccatcatatgcacatgaatgtcaaaaagaaaaagagatagagttg |
2631745 |
T |
 |
| Q |
216 |
ggacatgatctttaatttaaatcaagccaagccagatgtctatcttataagttagagttagcaatgccccaactagagataggacaacgactccatta |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2631746 |
ggacatgatctttaatttaaatcaagccaagccagatgtctatcttataagttagagttagcaatgccccaactagagataggacaacgactccatta |
2631843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University