View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_high_5 (Length: 329)
Name: NF1395_high_5
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 48276683 - 48276963
Alignment:
| Q |
1 |
gagaggtaacggcggctcgttgactgcactccctcatcagttgttaggtttggatcatgatagtagttcaattcatcatcaatatcaccaacaccaatct |
100 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48276683 |
gagaggtaacggcggcgcgttgacggcactccctgatcagttgttaggtgtggatcatgatagtagttcaattcatcatcaatatcaccaacagcaatct |
48276782 |
T |
 |
| Q |
101 |
gggttgatgtcacactctagagttctgaaaaaccaagcagaaaagcaacgtgcggggacacatgatgagtccgaggaatcggagtcgtcttccacgttcg |
200 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||| | |
|
|
| T |
48276783 |
gggttgatgtcatactctagagtggtgaaaaaccaagcagaaaagcaacgtgcggggacac---atgagtcagaggaatcgga---gtcttccacgttgg |
48276876 |
T |
 |
| Q |
201 |
gaagtagaacaagaacagaagattgttcttatgtttatgctaattctcaaactcaaaggaaccaactccttacactattctgatgat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48276877 |
gaagtagaacaagaacagaagattgttcttatgtttatgctaattctcaaactcaaaggaaccaactccttacactattcttatgat |
48276963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University