View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_low_10 (Length: 330)
Name: NF1395_low_10
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 97 - 221
Target Start/End: Complemental strand, 38005691 - 38005567
Alignment:
| Q |
97 |
aacatagttgttttatcaccttcgcttgagccacacggcactgttcgatcaacacgaagagctcgaatcgtcagcattgcattcgagttgttttacaaca |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
38005691 |
aacatcgttgttttatcaccttcgcttgagccacacggcactgttcgatcaacacgaagagctcgaatcgtcggcattgcatttgagttgttttacaaca |
38005592 |
T |
|
| Q |
197 |
aaatctcgcaaatgccagttgcacc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38005591 |
aaatctcgcaaatgccagttgcacc |
38005567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 97 - 221
Target Start/End: Original strand, 26462122 - 26462246
Alignment:
| Q |
97 |
aacatagttgttttatcaccttcgcttgagccacacggcactgttcgatcaacacgaagagctcgaatcgtcagcattgcattcgagttgttttacaaca |
196 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
26462122 |
aacatcgttgttttatcgccttcgcttgagccacacggcactgttcggtcaacacgaagagctcgaatcgtaggcattgcattcgagttgttttacagca |
26462221 |
T |
|
| Q |
197 |
aaatctcgcaaatgccagttgcacc |
221 |
Q |
| |
|
|||| || ||||||| ||| |||| |
|
|
| T |
26462222 |
aaatatctgaaatgcctgtttcacc |
26462246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University