View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_low_11 (Length: 330)
Name: NF1395_low_11
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 86 - 221
Target Start/End: Complemental strand, 38005702 - 38005567
Alignment:
| Q |
86 |
cgactgatatgaacatagttgttttatcaccttcgcttgagccacacggcactgttcgatcaacacgaagagctcgaatcgtcagcattgcattcgagtt |
185 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
38005702 |
cgactgatctaaacatcgttgttttatcaccttcgcttgagccacacggcactgttcgatcaacacgaagagctcgaatcgtcggcattgcatttgagtt |
38005603 |
T |
|
| Q |
186 |
gttttacaacaaaatctcgcaaatgccagttgcacc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38005602 |
gttttacaacaaaatctcgcaaatgccagttgcacc |
38005567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 88 - 221
Target Start/End: Original strand, 26462113 - 26462246
Alignment:
| Q |
88 |
actgatatgaacatagttgttttatcaccttcgcttgagccacacggcactgttcgatcaacacgaagagctcgaatcgtcagcattgcattcgagttgt |
187 |
Q |
| |
|
|||||| | ||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26462113 |
actgatctaaacatcgttgttttatcgccttcgcttgagccacacggcactgttcggtcaacacgaagagctcgaatcgtaggcattgcattcgagttgt |
26462212 |
T |
|
| Q |
188 |
tttacaacaaaatctcgcaaatgccagttgcacc |
221 |
Q |
| |
|
|||||| |||||| || ||||||| ||| |||| |
|
|
| T |
26462213 |
tttacagcaaaatatctgaaatgcctgtttcacc |
26462246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University