View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1395_low_14 (Length: 317)

Name: NF1395_low_14
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1395_low_14
NF1395_low_14
[»] chr5 (1 HSPs)
chr5 (114-221)||(11729990-11730097)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 114 - 221
Target Start/End: Original strand, 11729990 - 11730097
Alignment:
114 gtcacttccgtagctctgaaaagattcttccttggttgaaaaatgttaaagtagcgatagtcgagtttaacgatttgatagaagatatcaatctcaagga 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11729990 gtcacttccgtagctctgaaaagattcttccttggttgaaaaatgttaaagtagcgatagtcgagtttaacgatttgatagaagatatcaatctcaagga 11730089  T
214 gagtattg 221  Q
    ||||||||    
11730090 gagtattg 11730097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University