View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_low_14 (Length: 317)
Name: NF1395_low_14
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 114 - 221
Target Start/End: Original strand, 11729990 - 11730097
Alignment:
| Q |
114 |
gtcacttccgtagctctgaaaagattcttccttggttgaaaaatgttaaagtagcgatagtcgagtttaacgatttgatagaagatatcaatctcaagga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11729990 |
gtcacttccgtagctctgaaaagattcttccttggttgaaaaatgttaaagtagcgatagtcgagtttaacgatttgatagaagatatcaatctcaagga |
11730089 |
T |
 |
| Q |
214 |
gagtattg |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
11730090 |
gagtattg |
11730097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University