View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_low_16 (Length: 312)
Name: NF1395_low_16
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 91 - 239
Target Start/End: Original strand, 7906488 - 7906636
Alignment:
| Q |
91 |
tgagcaatattatcaacactttgtgaatcatgttcaacataagcagaattataagcattacaaaacagtttgtgcgattggcggagaaattgaagaaaca |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
7906488 |
tgagcaatattatcaacactttgtgaatcatgttcaacataagcagatttataaacatcacaaaacagtttgtgtggttggcggagaaattgaagaaaca |
7906587 |
T |
|
| Q |
191 |
agccacgattgaacgagattgttacacctctcccaaacatcgtaattca |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7906588 |
agccacgattgaacgagattgttacacagctcccaaacatcgtaattca |
7906636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University