View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_low_17 (Length: 310)
Name: NF1395_low_17
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 89 - 242
Target Start/End: Complemental strand, 2140195 - 2140042
Alignment:
| Q |
89 |
ttacatagttcacctgcaccaaatattttaatttttcaaacttctttttaacnnnnnnntatgctaccatctaacattatgttaatgcttaaattgataa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2140195 |
ttacatagttcacctgcaccaaatattttaatttttcaaacttctttttaacaaaataatatgctaccatctaacattatgttaatgcttaaattgataa |
2140096 |
T |
|
| Q |
189 |
tgactttagcaaaatcattgtcatttagtaattttgttaaaatttaagtataat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2140095 |
tgactttagcaaaatcattgtcatttagtaattttgttaaaatttaagtataat |
2140042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University