View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_low_19 (Length: 304)
Name: NF1395_low_19
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 29 - 292
Target Start/End: Original strand, 47039565 - 47039826
Alignment:
| Q |
29 |
actttgggagggaagaaaacggtgtacggacaagaaagtggttgccatttgtttctgatacacaaaatctatcaccttgttttgtatggtggaacaataa |
128 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47039565 |
actttgggagggaagaaa-cggtgtacggacaagaaagtggttgccatttgttt-tgatacacaaaatctatcaccttgttttgtgtggtggaacaataa |
47039662 |
T |
|
| Q |
129 |
gaacgatattacagctatgcccatcattttgtgacatcattataacatgtctaagggcattaaagtaataaaagtgtgaatattaaataaccacgggatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47039663 |
gaacgatattacagctatgcccatcattttgtgacatcattataacatgtctaagggcattaaagtaataaaagtgtgaatattaaataaccacgggatt |
47039762 |
T |
|
| Q |
229 |
cattatgggtcttatctttttcacaacttcatcacattgaaaccgataacagttcactccttca |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47039763 |
cattatgggtcttatctttttcacaacttcatcacattgaaaccgataacagttcactccttca |
47039826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University