View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_low_20 (Length: 299)
Name: NF1395_low_20
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 74 - 238
Target Start/End: Complemental strand, 2147048 - 2146884
Alignment:
| Q |
74 |
agttcgataaaagaattattcaatggaaagaattgtcaagtactaatgcaattgaaatgtagaactcaacaattgtttattatgaattgcaggttatcat |
173 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2147048 |
agttcgataaaagaatcattcaatggaaagaattgtcaagtactaatgcaattgaaatgtagaactcaacaattgtttattatgaattgcaggttatcat |
2146949 |
T |
|
| Q |
174 |
agaacttccccacatcttggttcaggctgttgtatatgggatcatagtgtatgccatgatgggat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2146948 |
agaacttccccacatcttggttcaggctgttgtatatgggatcatagtatatgccatgatgggat |
2146884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 238
Target Start/End: Complemental strand, 2158879 - 2158805
Alignment:
| Q |
164 |
aggttatcatagaacttccccacatcttggttcaggctgttgtatatgggatcatagtgtatgccatgatgggat |
238 |
Q |
| |
|
||||||| ||||| ||||| ||||||||||||||| | | |||||||||||||| || ||||| |||||||||| |
|
|
| T |
2158879 |
aggttattatagagcttccacacatcttggttcagaccctagtatatgggatcattgtatatgctatgatgggat |
2158805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University