View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_low_29 (Length: 251)
Name: NF1395_low_29
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_low_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 123 - 251
Target Start/End: Original strand, 5980174 - 5980302
Alignment:
| Q |
123 |
catccatatctcaaagcacaaagaagatcataaaaatgtgtgaatatacaatttaagtggcgattttgataagactgactataagcattacaagttgaat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5980174 |
catccatatctcaaagcacaaagaagatcataaaaatgtgtgattatacaatttaagtggcgattttgataagactgactataagcattacaagttgaat |
5980273 |
T |
 |
| Q |
223 |
taaactgtaattgatttttcttatcctca |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
5980274 |
taaattgtaattgatttttcttatcctca |
5980302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University