View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1395_low_8 (Length: 352)
Name: NF1395_low_8
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1395_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 51 - 338
Target Start/End: Original strand, 15673064 - 15673362
Alignment:
| Q |
51 |
ttggtatcaagagccctcatagggttatgcgaaggtttagcaaaaaca-----------ttcatgtatcaagagggtaaactgatcatttttagcaaaat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15673064 |
ttggtatcaagagccctcatagggttatgtgaaggtttggcaaaaacattcatgtaacattcatgtatcaagagggtaaactgatcatttttagcaaaat |
15673163 |
T |
 |
| Q |
140 |
atgggagcaggagtacaatttcgagggtccatataccatcgtaattaagggactactcgagctggattggcccagcaaaaaccaatgatgataggctatt |
239 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15673164 |
atgggggcaggagtacaatttcgagggtccatatatcatcgtaattaagtgactactcgagctggattggcccagcaaaaaccaatgatgataggctatt |
15673263 |
T |
 |
| Q |
240 |
ttgtcttggaaaattgctccttttcactttcaaaatgtctttcagacacttcaaaaatacaaaaacgtcttcggcggtagttaaccgtcattgttcctt |
338 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15673264 |
ttgtcttggaaaattgctctttttcactttcaaaatgtctttgagacacttcaaaaatacaaaaacgtcttcggcggtagttaaccgtcattgttcctt |
15673362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University