View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1396-INSERTION-3 (Length: 244)
Name: NF1396-INSERTION-3
Description: NF1396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1396-INSERTION-3 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 244
Target Start/End: Original strand, 49614641 - 49614882
Alignment:
| Q |
8 |
acctttcccgcaacagaaacatctagtgatgaggttaaggaaaacttgatttacaagaaggaaggagaaggcaacaaatccgtagaaggtggaagcatcg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49614641 |
acctttcccgcaacagaaacatctagtgatgaggttaaggaaaacttgatttacaagaaggaaggagaaggcaacaaatccgtagaaggtggaagcatcg |
49614740 |
T |
|
| Q |
108 |
gtggtgtatacgcagatagttccgtcgtcgttgggaagctcttcagcctgaaaaggtaaagggattaaaagagaattgagaaaca----aactaaaaaag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| || ||||||| |
|
|
| T |
49614741 |
gtggtgtatacgcagatagttccgtcgtcgttgggaagctcttcagcctgaaaaggtaaagggatt-aaagagatttgagaaacaaaacaaaaaaaaaag |
49614839 |
T |
|
| Q |
204 |
tagtggtgtgaattaat--gagataatggttacccagtaacga |
244 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49614840 |
tagtggtgtgaattaatgagagataatggttacccagtaacga |
49614882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 8 - 172
Target Start/End: Original strand, 49609561 - 49609726
Alignment:
| Q |
8 |
acctttcccgcaacagaaacatctagtgatgaggttaaggaaaacttgatttacaagaaggaaggagaaggcaacaaatccgtagaaggtggaagcatcg |
107 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||| |||| ||||||| ||||||| |||| |
|
|
| T |
49609561 |
acctttaccgcagcagaaacatctagtgatgaggttaaggaaaacttgatttataagaaggcagaagaaggcaccaaagccgtagatggtggaatcatca |
49609660 |
T |
|
| Q |
108 |
gtggtgtatacgcagatagttccgtcgtcgttgggaagctcttcagcctgaaaag-gtaaagggat |
172 |
Q |
| |
|
||| ||| || ||||||||| ||||| | ||||||| |||| |||||||||| |||||||||| |
|
|
| T |
49609661 |
gtgtcgtaaacacagatagtttcgtcgacattgggaatctctaaggcctgaaaagcgtaaagggat |
49609726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University