View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13960_high_16 (Length: 246)
Name: NF13960_high_16
Description: NF13960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13960_high_16 |
 | |
|
| [»] scaffold0024 (2 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 17750663 - 17750892
Alignment:
| Q |
1 |
gtagagaatcaaaattcagacgctgtcagaactgagccagacttcttcggtagtagtgatctgaatatgctctcttaatacaaggtaattctaaaataaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17750663 |
gtagagaatcaaaattcaaacgctgtcagaactgagcctgacttcttcggtagtagtgaactgaatatgctctcttaatacaaggtaattctaaaataaa |
17750762 |
T |
|
| Q |
101 |
attagcttaattttcttgaatgataccattaagatttaggctcttgctagttttctaaaggatgcgcacattaaaacttgaagatgctgctgttactgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17750763 |
attagcttaattttcttgaatgataccattaagatttaggctcttgctagttttctaaaggatgcgcacattaaaacttgaagatgctgctgttactgat |
17750862 |
T |
|
| Q |
201 |
gatgaaaaatggtttatttatggttagcag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17750863 |
gatgaaaaatggtttatttatggttagcag |
17750892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 139898 - 139837
Alignment:
| Q |
102 |
ttagcttaattttcttgaatgataccattaagatttaggctcttgctagttttctaaaggat |
163 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
139898 |
ttagcttaattttcttgaatgatactattaagatttgagctcttgctagttttctaaaggat |
139837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 100 - 158
Target Start/End: Complemental strand, 128914 - 128857
Alignment:
| Q |
100 |
aattagcttaattttcttgaatgataccattaagatttaggctcttgctagttttctaa |
158 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||||| | |||||||||||||||||| |
|
|
| T |
128914 |
aattagtttaatttt-ttgaataataccattaagattttgtctcttgctagttttctaa |
128857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 144
Target Start/End: Complemental strand, 6912060 - 6911978
Alignment:
| Q |
62 |
tgaatatgctctcttaatacaaggtaattctaaaataaaattagcttaattttcttgaatgataccattaagatttaggctct |
144 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| || || ||||||||| || ||||||||||| || ||||||||||||| |
|
|
| T |
6912060 |
tgaatatgctttcttgttacaaggtaattctagaaacaatttagcttaacttctgtgaatgatacctttgagatttaggctct |
6911978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University