View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13960_low_18 (Length: 240)
Name: NF13960_low_18
Description: NF13960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13960_low_18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 35695441 - 35695218
Alignment:
| Q |
18 |
gttgagacactgtcaacttacttgtagaaccgacactgcatgcgctgatggctaaatgtaaacacacgccgtaatttgatacaaaatcacaaagactagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35695441 |
gttgagacactgtcaacttacttgtagaaccgacactgcatgcattgatggctaaatgtaaacacacgccgtaatttgatacaaaatcacaaagactagt |
35695342 |
T |
|
| Q |
118 |
atcatggggataaaaaggttaggctttctg-tttaagaaatagacacgcactcttcttaatttggaaatgtactaggatagtgcattaggttagttatgg |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
35695341 |
atcatggggataaaaaggttagactttctgttttaagaaatagacacgcactcttcttaatttggaaatgtactaggatagtgtattaggttatttatgg |
35695242 |
T |
|
| Q |
217 |
cagcacagtacaagaccaaaatat |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35695241 |
cagcacagtacaagaccaaaatat |
35695218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University