View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13960_low_22 (Length: 226)
Name: NF13960_low_22
Description: NF13960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13960_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 11399816 - 11399996
Alignment:
| Q |
17 |
attctccagaccaaaacagaaattttcaaaggaattatagggttccaaannnnnnnatgcgccagtgttaccaatttctaaagaggaagttctagtcaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11399816 |
attctccagaccaaaacagaaattttcaaaggaattatagggttccaaatttttttatgcgccagtgttaccaatttctaaagaggaagttctagtcaat |
11399915 |
T |
 |
| Q |
117 |
tttttgtaattgtctctcaccgagcactctctaccacacctatcactccaaatctctttccaccaaagtgatttgcaaatcccccttctgctctc |
211 |
Q |
| |
|
|||| || |||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11399916 |
tttt-----ttatctctcaccgtgcactct---------ctatcactccaaatctctttccaccaaagtgatttgcaaatcccccttctgctctc |
11399996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University