View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13960_low_25 (Length: 220)
Name: NF13960_low_25
Description: NF13960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13960_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 36394471 - 36394276
Alignment:
| Q |
13 |
agcacagacattaactgctctagatctgattcatttcctaccccccgatctttactactcaaaatga-tcggaaaaagactatgtacctcaccacattaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36394471 |
agcacagacattaactgctctagatctgcttcatttcctaccccccgatctttactactcaaaatgaatcggaaaaagactatgtacctcaccacattaa |
36394372 |
T |
 |
| Q |
112 |
gataagattgaattacaatagatactaactaccttcccaagtactaagtaatgg-ttccgtgttgatccctatctctccatccattatatatagag |
206 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||| || || |||||||||||||||||||||||||||||||||| |
|
|
| T |
36394371 |
gataagattgaattacaatagatactagctaccttcccaactactaagtaatggttttagtattgatccctatctctccatccattatatatagag |
36394276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University