View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13961_low_12 (Length: 213)
Name: NF13961_low_12
Description: NF13961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13961_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 23 - 196
Target Start/End: Complemental strand, 32809362 - 32809192
Alignment:
| Q |
23 |
acctagttctgtggcgctgtgcattgtggaggaacgtctgctggatcgccttcgccgggaattgtctattagttgtagggtcgacttccagatccttctt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||||| | ||| |
|
|
| T |
32809362 |
acctagttctgtggcgctgtgcattgtggaggaacgtctggtggatcgccttcgccggtaattgtctattagttgtagggtggacttccagacc---ctt |
32809266 |
T |
|
| Q |
123 |
ctatgcctttgtacaatttgcctccaaatttgatgcctacaatggagggcatatgggacatgaggctcttgcct |
196 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32809265 |
ctatgcttttgtacaatttgcctccaaatttgatgcctacaatggagggcatatgggacatgaggctcttgcct |
32809192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 64 - 196
Target Start/End: Complemental strand, 32802755 - 32802622
Alignment:
| Q |
64 |
tggatcgccttcgccgggaattgtctattagttgtagggtcgacttccagatccttcttctatgcctttgtacaatttgcctccaaatttgatgcct-ac |
162 |
Q |
| |
|
|||||||||| | || ||||||| || ||||| ||||| | ||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||| | |
|
|
| T |
32802755 |
tggatcgcctccaccaggaattggtcatcagttgcagggtgggcttccagatccttcttccatgcctttgtataatttgccaccaaatttgttgcctaat |
32802656 |
T |
|
| Q |
163 |
aatggagggcatatgggacatgaggctcttgcct |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
32802655 |
aatggagggcagatgggacatgaggctcttgcct |
32802622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 151
Target Start/End: Original strand, 16579204 - 16579248
Alignment:
| Q |
107 |
cttccagatccttcttctatgcctttgtacaatttgcctccaaat |
151 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||| |||||| |
|
|
| T |
16579204 |
cttccagatccatcttctatgcctttgtataatttgccaccaaat |
16579248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University