View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13962_high_7 (Length: 213)
Name: NF13962_high_7
Description: NF13962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13962_high_7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 7 - 213
Target Start/End: Original strand, 9587504 - 9587710
Alignment:
| Q |
7 |
gttcactcttccattgcacttctacaagagaggtttagacaattggaaagagttaaagaaatnnnnnnnnnnnnnnnnctaaagaaaatgctcaatgaac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
9587504 |
gttcactcttccattgcacttctacaagagaggtttagacaattggaaagagtaaaagaaatgagagaagagagagagctaaagaaaatgctcaatgaac |
9587603 |
T |
 |
| Q |
107 |
caaaacaattcaattcaaataccattcctagttatgattatgatcaatcaacaaggttgttttcttccaaccatgaattgatcataccatcaaagtcttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9587604 |
caaaacaattcaattcaaataccattcctagttatgattatgatcaatcaacaaggttgttttcttccaaccatgaattgatcataccatcaaagtcttc |
9587703 |
T |
 |
| Q |
207 |
accacct |
213 |
Q |
| |
|
||||||| |
|
|
| T |
9587704 |
accacct |
9587710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 68
Target Start/End: Original strand, 55939143 - 55939183
Alignment:
| Q |
28 |
ctacaagagaggtttagacaattggaaagagttaaagaaat |
68 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
55939143 |
ctacaagagaggtttagacagttgcaaagagtgaaagaaat |
55939183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University