View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13962_low_4 (Length: 265)
Name: NF13962_low_4
Description: NF13962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13962_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 32 - 249
Target Start/End: Complemental strand, 37658242 - 37658025
Alignment:
| Q |
32 |
cttgtgaattacaccattttcttcctagttcctagactaaaatgtatacataaagaaacaaaatagttgaaacagagcatgtcaatgagcaacaacacca |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
37658242 |
cttgtgaattacaccattttcttcctagttcctagactaaaatgtatacataaagaaacaaaatagttgaaacagagcatatcaatgagcaacaccacca |
37658143 |
T |
 |
| Q |
132 |
ccaccatcactatcctttttccttgtaacacgaatgtagcaaaaaacaacagcaaaagttgcactaactaacccaccaatgatcacacctccaccagcca |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37658142 |
ccaccatcactatcctttttccttgtaacacgaatgtagcaaaaaacaacagcaaaagttgcactaactaacccaccaatgatcacacctccaccagcca |
37658043 |
T |
 |
| Q |
232 |
tttctgacgatgaagaat |
249 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
37658042 |
tttctgatgatgaagaat |
37658025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University