View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13963_high_10 (Length: 277)
Name: NF13963_high_10
Description: NF13963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13963_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 23 - 241
Target Start/End: Complemental strand, 33844537 - 33844319
Alignment:
| Q |
23 |
acctcagtattgccaacttctctccatgactttgttgagcttgttttccagaatgatgaaaacaccatgcaatcttggcatcttgatggttatgattttt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33844537 |
acctcagtattgccaacttctctccatgactttgttgagcttgttttccagaatgatgaaaacaccatgcaatcttggcatcttgatggttatgattttt |
33844438 |
T |
|
| Q |
123 |
gggttgtggggtatgtaatcttttcattattttcattttgctttaatcatgtttacgtgctttattaaaaataatcatcgttgcttaaaattgttttaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33844437 |
gggttgtggggtatgtaatcttttcattattttcattttgctttaatcatgtttacatgctttattaaaaataatcatcgttgcttaaaattgttttaag |
33844338 |
T |
|
| Q |
223 |
ggggagataatgatgatgt |
241 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
33844337 |
ggggagatgatgatgatgt |
33844319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 32 - 138
Target Start/End: Original strand, 6798720 - 6798826
Alignment:
| Q |
32 |
ttgccaacttctctccatgactttgttgagcttgttttccagaatgatgaaaacaccatgcaatcttggcatcttgatggttatgatttttgggttgtgg |
131 |
Q |
| |
|
|||| |||||| || ||||| || ||||| |||||||||| || |||||||||||||||| |||||||||||||| |||||||||||||||||||| | |
|
|
| T |
6798720 |
ttgcgaacttcgcttcatgatttcattgaggttgttttccaaaacaatgaaaacaccatgcagtcttggcatcttgacggttatgatttttgggttgttg |
6798819 |
T |
|
| Q |
132 |
ggtatgt |
138 |
Q |
| |
|
||||||| |
|
|
| T |
6798820 |
ggtatgt |
6798826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University