View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13963_high_8 (Length: 314)
Name: NF13963_high_8
Description: NF13963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13963_high_8 |
 | |
|
| [»] scaffold0027 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0027 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 260
Target Start/End: Original strand, 46079 - 46325
Alignment:
| Q |
11 |
gatatttgttgcgcttagattttacatatcagtttagactcattttcaactaatgatcacttatacatcaacactacatattcaaatgcgtatttagatc |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46079 |
gatatttgttgcacttagattttacatatcagtttagactcattttcaactaatgatcacttatacatcaacactacatattcaaatgcgtatttagatc |
46178 |
T |
|
| Q |
111 |
gctttaatcatgtaactttttgtaggcattattataccgatttatgatattgacttcaatgatgtaaatttagttgcaaattcatcttttaagtttcaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46179 |
gctttaatcatgtaactttttgtaggc---attataccgatttatgatattgacttcaatgatgtaaatttagttgcaatttcatcttttaagtttcaat |
46275 |
T |
|
| Q |
211 |
gacacaaaatttttattgttcttgattttatctaccgattcaaatgaata |
260 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
46276 |
gacacaaaatttttattgttgttgattttatctaccgatttaaatgaata |
46325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 201
Target Start/End: Complemental strand, 51629039 - 51628989
Alignment:
| Q |
151 |
tttatgatattgacttcaatgatgtaaatttagttgcaaattcatctttta |
201 |
Q |
| |
|
|||||| |||| |||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
51629039 |
tttatgctattaacttaaatgatgtgaatttatttgcaaattcatctttta |
51628989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University