View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13963_low_12 (Length: 246)
Name: NF13963_low_12
Description: NF13963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13963_low_12 |
 | |
|
| [»] scaffold0027 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0027 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 45720 - 45930
Alignment:
| Q |
9 |
atgaacctgattctttgggatcattctggtatagaaaacagtgtttgaacagtaaaaaatctgcatgtgggtgcagtcactatgtaattagcctgaaatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45720 |
atgaacctgattctttgggatcattctggtatagaaaacagtgtttgaacagtaaaaaatttgcatgtgggtgcagtcactatgtaattagcctgaaatt |
45819 |
T |
|
| Q |
109 |
gagcataggattcctatcacatagaggtactcctacgtactccctcatttttgtagggatgatgctactcggcattccaaatctttgtttcttttaataa |
208 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45820 |
gaacataggattcctatcacatagaggtactcc----tactccctaatttttgtagggaagatgctactcggcattccaaatctttgtttcttttaataa |
45915 |
T |
|
| Q |
209 |
aaattctttcatgag |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45916 |
aaattctttcatgag |
45930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University