View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13963_low_13 (Length: 238)
Name: NF13963_low_13
Description: NF13963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13963_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 375116 - 374895
Alignment:
| Q |
1 |
tatcataaaccctaagcaagaaaataataaattatttattctgcaattgaaagaagtcttttcttatagctaactatttgacagcaaatgaatatccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
375116 |
tatcataaaccctaagcaagaaaataataaattatttattctgcaattgaaagaagacttttcttatagctaactatttgacagcaaatgaacatccttt |
375017 |
T |
 |
| Q |
101 |
taatgccaagctcttgaattgtgtgggtaactaaatcacacttggctacttcttcttcatcttcttttacgaagaatatatccccatatgtatacaattt |
200 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
375016 |
taatgccaagctcttaaattgcttgggtaactaaatcacacttggctacttcttcttcatcttcttttacgaagaatatatccctgtaggtatacaattt |
374917 |
T |
 |
| Q |
201 |
ctaaccttcttatttgaaagat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
374916 |
ctaaccttcttatttgaaagat |
374895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University