View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13963_low_17 (Length: 226)
Name: NF13963_low_17
Description: NF13963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13963_low_17 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 127 - 226
Target Start/End: Complemental strand, 35473689 - 35473590
Alignment:
| Q |
127 |
catgagatgtctttattaccaaccataaggttttatatgtcgcaatcgcacgtgttggtgcaatctttgagattgcaaataattgtagttaaacttaagc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473689 |
catgagatgtctttattaccaaccataaggttttatatgtcgcaatcgcacgtgttgttgcaatctttgagattgcaaataattgtagttaaacttaagc |
35473590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 6 - 43
Target Start/End: Complemental strand, 35473808 - 35473771
Alignment:
| Q |
6 |
attataaactttacaatatttcaagttctattgacaac |
43 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35473808 |
attataaactttacaatatttcgagttctattgacaac |
35473771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University