View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13964_high_9 (Length: 265)

Name: NF13964_high_9
Description: NF13964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13964_high_9
NF13964_high_9
[»] chr8 (1 HSPs)
chr8 (28-242)||(42948659-42948873)


Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 28 - 242
Target Start/End: Original strand, 42948659 - 42948873
Alignment:
28 cagagacgatgacaacgacggagataatggtgacgacggaaaagatgaagaagacgacgacaacgtttgcctcgtctaaaaaagcaacaagaagactgag 127  Q
    ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
42948659 cagagacgatgacgacgacggagatgatggtgacgacggaaaagatgaagaagacgacggcaacgtttgcctcgtctaaaaaagcaacaagaagactgag 42948758  T
128 tcgaattagttatggcgacgaaactgcattttgccgatggtctaacggagaagaaggtggaacagcatctctacttgcttctgatttcaaggatcgttca 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42948759 tcgaattagttatggcgacgaaactgcattttgccgatggtctaacggagaagaaggtggaacagcatctctacttgcttctgatttcaaggatcgttca 42948858  T
228 gatttgtgaactttc 242  Q
    |||||||||||||||    
42948859 gatttgtgaactttc 42948873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University