View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13964_low_10 (Length: 265)
Name: NF13964_low_10
Description: NF13964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13964_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 28 - 242
Target Start/End: Original strand, 42948659 - 42948873
Alignment:
| Q |
28 |
cagagacgatgacaacgacggagataatggtgacgacggaaaagatgaagaagacgacgacaacgtttgcctcgtctaaaaaagcaacaagaagactgag |
127 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42948659 |
cagagacgatgacgacgacggagatgatggtgacgacggaaaagatgaagaagacgacggcaacgtttgcctcgtctaaaaaagcaacaagaagactgag |
42948758 |
T |
 |
| Q |
128 |
tcgaattagttatggcgacgaaactgcattttgccgatggtctaacggagaagaaggtggaacagcatctctacttgcttctgatttcaaggatcgttca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42948759 |
tcgaattagttatggcgacgaaactgcattttgccgatggtctaacggagaagaaggtggaacagcatctctacttgcttctgatttcaaggatcgttca |
42948858 |
T |
 |
| Q |
228 |
gatttgtgaactttc |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42948859 |
gatttgtgaactttc |
42948873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University