View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13964_low_11 (Length: 245)
Name: NF13964_low_11
Description: NF13964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13964_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 231
Target Start/End: Complemental strand, 32914632 - 32914420
Alignment:
| Q |
19 |
attaagtaatatgggtaattaatatagcacaaaccatcatattgaaatttttagtgcacgcacatgcccctgcacaacttgttgtagatccatccatgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32914632 |
attaagtaatatgggtaattaatatagcacaaaccatcatattgaaatttttagtgcatgcacatgcccctgcacaacttgttgtagatccatccatgaa |
32914533 |
T |
 |
| Q |
119 |
attggtaagtttgttgtttctcatactacaatttattgaatagttgttctttgtattattcattatcttcaaaacaatcaattttagagttttattttct |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32914532 |
attggtaagtttgtcgtttctcatactacaatttattgaatagttgttctttgtattattcattatcttcaaaacaatcaattttagagttttattttct |
32914433 |
T |
 |
| Q |
219 |
ctcatattcttct |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32914432 |
ctcatattcttct |
32914420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University