View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13964_low_12 (Length: 238)
Name: NF13964_low_12
Description: NF13964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13964_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3919251 - 3919031
Alignment:
| Q |
1 |
cattctaaaataaaccaagattttcattatttacaagctagtacaatcaataatttcacatattgtggtcaacaaggcacaaaaaccaatgacatagtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3919251 |
cattctaaaataaaccaagattttcattatttacaagctagtacaatcaataatttcacatattgtagtcaacaaggcacaaaaaccaatgacatagtaa |
3919152 |
T |
 |
| Q |
101 |
taaaatctagtgggatccaagtgaagtgacacaaaatttgataaaccaataacacatagatagcaccttcagatcaatataaaggaatcaaggtagtgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3919151 |
taaaatctagtgggatccaagtgaagtgacacaaaatttgataaaccaataacacatagatagcaccttcagatcaatataaaggaatcaaggtagtgta |
3919052 |
T |
 |
| Q |
201 |
gtaaaagaggcaattgatacc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3919051 |
gtaaaagaggcaattgatacc |
3919031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University