View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13964_low_13 (Length: 216)
Name: NF13964_low_13
Description: NF13964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13964_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 13854987 - 13855171
Alignment:
| Q |
17 |
atgaatgcgaagggggtgagatggaggttgtattggtgtagactagagttgtttgagtgggaaaaggagaggctccttgagcttttgggacggttggaag |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13854987 |
atgaatgcggagggggtgagatggaggttgtattggcgtagactagagttgtttgagtgggaaaaggagaggctccttgagcttttgggacggttggaag |
13855086 |
T |
|
| Q |
117 |
gggtggtcctaaggtaccgggcggatatttgggtgtggaaaccggataaagagggagttttttccgttaattcttgctattttct |
201 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13855087 |
gggtggtcctaaggtactgggcggatatttgggtgtggaaaccggataaagagggagttttttctgttaattcttgctattttct |
13855171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 61 - 198
Target Start/End: Original strand, 26490130 - 26490267
Alignment:
| Q |
61 |
agagttgtttgagtgggaaaaggagaggctccttgagcttttgggacggttggaaggggtggtcctaaggtaccgggcggatatttgggtgtggaaaccg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||| | ||| ||||||||| ||||||||||||||||| |||||| ||| |||||||||||||||||||| || |
|
|
| T |
26490130 |
agagttgtttgaatgggaaaaggagaggtttattgggcttttgggtcggttggaaggggtggtgctaaggaacctaccggatatttgggtgtggaaatcg |
26490229 |
T |
|
| Q |
161 |
gataaagagggagttttttccgttaattcttgctattt |
198 |
Q |
| |
|
| |||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
26490230 |
ggtaaagagggagtgttttccgttcattcttgctattt |
26490267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 198
Target Start/End: Complemental strand, 30635794 - 30635705
Alignment:
| Q |
108 |
ggttggaaggggtggtcctaaggtaccgggcggatatttgggtgtggaaaccggataaagagggagttttttccgttaattcttgctattt |
198 |
Q |
| |
|
||||||||||||||||||||| | ||| | |||||||||||| |||||| ||||||||||| ||| ||||||| |||||||||| ||||| |
|
|
| T |
30635794 |
ggttggaaggggtggtcctaaagaaccagttggatatttgggtatggaaatcggataaagagagag-tttttccattaattcttgttattt |
30635705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 186
Target Start/End: Original strand, 17778138 - 17778178
Alignment:
| Q |
146 |
tgggtgtggaaaccggataaagagggagttttttccgttaa |
186 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
17778138 |
tgggtgtggaaatcggataaagatggggttttttccgttaa |
17778178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University