View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13964_low_9 (Length: 286)
Name: NF13964_low_9
Description: NF13964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13964_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 22 - 263
Target Start/End: Original strand, 35409851 - 35410092
Alignment:
| Q |
22 |
tcaggggtgtttagtttaggccaccaggtagcatttttatgatcagggtgccccatgttgatgaattctttgtaccaggactggagttcattgtcagaag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409851 |
tcaggggtgtttagtttaggccaccaggtagcatttttatgatcagggtgccccatgttgatgaattctttgtaccaggactggagttcattgtcagaag |
35409950 |
T |
|
| Q |
122 |
aaacggcattcaaatctttgtagtaatggttcacataggtcctgaccaacttctctatactagtccatatgaggagtccatcagccgcataaggataatc |
221 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409951 |
aaatggcattcaaatctttgtagtaatggttcacataggtcctgaccaacttctctatactagaccatatgaggagtccatcagccgcataaggataatc |
35410050 |
T |
|
| Q |
222 |
ttcaataagtagtctaatgccatgtggctgagtggcatctgg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35410051 |
ttcaataagtagtctaatgccatgtggccgagtggcatctgg |
35410092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University