View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13965_high_14 (Length: 259)
Name: NF13965_high_14
Description: NF13965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13965_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 50 - 168
Target Start/End: Original strand, 2173775 - 2173896
Alignment:
| Q |
50 |
tccgattttggggagtggg-cagatggtaagtggttgtagtggagtaaatggaggctgccattct--gtttgggaggaagagttttgcaagaagctggtg |
146 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2173775 |
tccgattttggggagtggggcagatggtaagtggttgtggcggagtaaatggaggctgccattctttgtttgggaggaagagttttgcaagaagctggtg |
2173874 |
T |
 |
| Q |
147 |
gagttggtctcttcgtttggta |
168 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2173875 |
gagttggtctcttcgtttggta |
2173896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 50
Target Start/End: Original strand, 2173719 - 2173751
Alignment:
| Q |
18 |
ttaagcaaggcttcccaagattttattagttgt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2173719 |
ttaagcaaggcttcccaagattttattagttgt |
2173751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University