View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13965_high_18 (Length: 239)
Name: NF13965_high_18
Description: NF13965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13965_high_18 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 117 - 239
Target Start/End: Original strand, 23237481 - 23237603
Alignment:
| Q |
117 |
atgtcctgttacttttcgcatttgggattggcttatcaagggagctgaccagccgtttgatctctctaccagtcagtctcttctcttgagcagcgtgggg |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
23237481 |
atgtgctgttacttttcgcatttgggattggcttatcaagggagctgaccagccgcttgatctctctacctgtcaatctcttctcttgagcagcgtgggg |
23237580 |
T |
 |
| Q |
217 |
attggaagcaagttagctcagct |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
23237581 |
attggaagcaagttagctcagct |
23237603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 79
Target Start/End: Original strand, 23237439 - 23237472
Alignment:
| Q |
46 |
actgacgaaaacctcaagaaaagaggttgttgca |
79 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
23237439 |
actgacgaaaacctcaagaaaagaggtcgttgca |
23237472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University