View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13965_low_17 (Length: 248)
Name: NF13965_low_17
Description: NF13965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13965_low_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 23 - 248
Target Start/End: Complemental strand, 2817088 - 2816863
Alignment:
| Q |
23 |
ttatacttcagaatttacaatacaacttgaaatttattatacaatcttcctgaacgagaaaaattaggtatacactctcaattatattatatggtacatc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2817088 |
ttatacttcagaatttacaatacaacttgaaatttattatacaatcttcctgaacgagaaaaattatgtatacactctcaattatattatatggtacatc |
2816989 |
T |
 |
| Q |
123 |
taagaacatgaacgtnnnnnnnnnnnnnnnnttatgctatcactatttgaaaattgctcaataggctccttgaattgcttacagacccctcaaacagtca |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2816988 |
taagaacatgaacgtaaaaaaaataaaaaaattatgctatcactattagaaaattgctcaataggctccttgaattgcttacagacccctcaaacagtca |
2816889 |
T |
 |
| Q |
223 |
aatatacccttcatggttcgtaactc |
248 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2816888 |
aatatacccttcatggttcgtaactc |
2816863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University