View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13965_low_21 (Length: 210)
Name: NF13965_low_21
Description: NF13965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13965_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 7906435 - 7906614
Alignment:
| Q |
18 |
ggttgttggtaaaccgagtgctccgtgggttccgtcgccgaaactcatcaccgtgctcatccatcgacgctgaataacaacactttctagcttcagcttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906435 |
ggttgttggtaaaccgagtgctccgtgggttccgtcgccgaaactcatcaccgtgctcatccatcgacgctgaataacaacactttctagcttcagcttc |
7906534 |
T |
|
| Q |
118 |
cgaaataatctctgtgatcgccacatttctttccgaattcattccgtggcggtctctcatgctttgttttgttctctgttcc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
7906535 |
cgaaataatctctgtgatcgccacatttctttccgaattcattccgtggcgg--tctcatgctttgttttgttgtcttttcc |
7906614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University