View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13966_low_4 (Length: 285)
Name: NF13966_low_4
Description: NF13966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13966_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 12450064 - 12449795
Alignment:
| Q |
1 |
aaactgaccttggtaccaatttcagactcataatcatatttttcaagagtttctgtaaactgatcaagagtaaacgaaacaccttccagtggagcagtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
12450064 |
aaactgaccttggtaccaatttcagactcataatcatatttttcaagagtttctgtaaactgatcaagagtaaacgaaacaccttccattggagcattac |
12449965 |
T |
 |
| Q |
101 |
gacaacgttcataagcattnnnnnnnngctctttaagctctgctctttctttgttattggcgctactaattgcaatggaacatacaataccagggcgtct |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12449964 |
gacaacgttcataagcattataaaaaagctctttaagctttgctctttctttgttattggcgctactaattgcaatggaacatacaataccagggcgtct |
12449865 |
T |
 |
| Q |
201 |
ttgtttatgggtttgtgttgttgttggtttacatatgaggggagtccattttgtgctggtcagttgttga |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
12449864 |
ttgtttatgggtttgtgttgttgttggtttacataggaggggactccattttgtgctggtcagttgttga |
12449795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University