View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13967_low_11 (Length: 237)
Name: NF13967_low_11
Description: NF13967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13967_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 392202 - 392422
Alignment:
| Q |
1 |
tcctgtattaaataaacaccgttaaattaaaaatgtcttatatatgtttatattttcatttcagttttaagtcgagcttctaggctggccattagctttt |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
392202 |
tcctgtattaaataaacaccattaaattaaaaatgacttatatatgtttatattttcatttcagttttaagtcgagcttctaggctggccattagcttt- |
392300 |
T |
 |
| Q |
101 |
cttgtttgaccatactttatttgttactcgcagttgcatgcattttggaattaggctctttatttgaatataaattacttcggtttatgtatgtgaaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
392301 |
cttgtttgaccatactttatttgttactggcagttgcatgcattttggaattaggctctttatttgaatataaattacttcggtttatgtatgtgaaatg |
392400 |
T |
 |
| Q |
201 |
catccttattgtatccaatggt |
222 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
392401 |
catccttattgcatccaatggt |
392422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University