View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13968_high_15 (Length: 328)
Name: NF13968_high_15
Description: NF13968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13968_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 148 - 327
Target Start/End: Original strand, 48303130 - 48303309
Alignment:
| Q |
148 |
accgcttatcagaagcacattctcatcttcaacctgaaccttgatgtccccagagttcaaccctggcatgtccaccacgaacacgtatgagtttggatac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48303130 |
accgcttatcagaagcacattctcatcttcaacctgaaccttgatgtcaccagatttcaaccctggcatgtccaccacgaacacgtatgagtttggatac |
48303229 |
T |
 |
| Q |
248 |
tctttcacgtctgctggtgttgcagccattgcttttgcgtcgcgaacgtaggttcgtgttggtgcgtttagattcatctc |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48303230 |
tctttcacgtctgctggtgttgcagccattgcttttgcgtcgcgaacgtaggttcgtgttggtgcgtttagattcttctc |
48303309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 19 - 91
Target Start/End: Original strand, 48303001 - 48303073
Alignment:
| Q |
19 |
acaaagagcagaaacaccaccttcaacatcagcattctctggtaacacaaatttcctcataaacttaccaacc |
91 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48303001 |
acaaacagcagaaacaccaccttcaacatcagcattctctggtaacacaaatttcctcataaacttaccaacc |
48303073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 149 - 237
Target Start/End: Original strand, 3744930 - 3745018
Alignment:
| Q |
149 |
ccgcttatcagaagcacattctcatcttcaacctgaaccttgatgtccccagagttcaaccctggcatgtccaccacgaacacgtatga |
237 |
Q |
| |
|
|||||||||| |||||| || |||||||| ||||||||||| || |||||||| ||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
3744930 |
ccgcttatcacaagcacgttatcatcttccacctgaaccttaatatccccagatttcaatcctggcatgtcaatcacgaacacgtatga |
3745018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 49 - 91
Target Start/End: Original strand, 3744827 - 3744869
Alignment:
| Q |
49 |
agcattctctggtaacacaaatttcctcataaacttaccaacc |
91 |
Q |
| |
|
||||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
3744827 |
agcattctcaggaagcacaaatttcctcataaacttaccaacc |
3744869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 153 - 261
Target Start/End: Complemental strand, 10462246 - 10462138
Alignment:
| Q |
153 |
ttatcagaagcacattctcatcttcaacctgaaccttgatgtccccagagttcaaccctggcatgtccaccacgaacacgtatgagtttggatactcttt |
252 |
Q |
| |
|
|||||| || ||| || ||||||||||||| ||||||||| || ||||| ||||| || |||| ||||| | |||| ||| |||||||| | || || || |
|
|
| T |
10462246 |
ttatcacaaccactttatcatcttcaacctcaaccttgatatcaccagatttcaatcccggcaagtccatctcgaatacgaatgagttttggtattcctt |
10462147 |
T |
 |
| Q |
253 |
cacgtctgc |
261 |
Q |
| |
|
||||||||| |
|
|
| T |
10462146 |
cacgtctgc |
10462138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University