View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13968_high_22 (Length: 240)
Name: NF13968_high_22
Description: NF13968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13968_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 62 - 223
Target Start/End: Complemental strand, 49057902 - 49057741
Alignment:
| Q |
62 |
acattgaatcaacattgattgcagaacaaatgcaatgttggatatgcattcatcaacatgactagtcctagcttgattatacctttctatgaggttagct |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49057902 |
acattgaatcaacattgattgcagaacaaatgcaatgctggatatgcattcatcaacatgactagtcctagcttgattatacctttctatgaggttagct |
49057803 |
T |
 |
| Q |
162 |
gccgaaaatgataattttgcgtggctaaaattaatcgcatgcatcacacatgcaccctgtat |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49057802 |
gccgaaaatgataattttgtgtggctaaaattaattgcatgcatcacacatgcaccctgtat |
49057741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 62 - 207
Target Start/End: Original strand, 6554651 - 6554795
Alignment:
| Q |
62 |
acattgaatcaacattgattgcagaacaaatgcaatgttggatatgcattcatcaacatgactagtcctagcttgattatacctttctatgaggttagct |
161 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||| ||||||| |
|
|
| T |
6554651 |
acatggaatcaacattgattgcagaacaaatgcaatgttggatatgcattcatcaacatgactagtcccagcttgattgtaccattctatcaggttagac |
6554750 |
T |
 |
| Q |
162 |
gccgaaaatgataat-tttgcgtggctaaaattaatcgcatgcatca |
207 |
Q |
| |
|
| |||||||||||| |||| |||||||||||||| ||| ||||| |
|
|
| T |
6554751 |
tcagaaaatgataatgattgc--ggctaaaattaatcacatacatca |
6554795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 114
Target Start/End: Complemental strand, 40158384 - 40158350
Alignment:
| Q |
80 |
ttgcagaacaaatgcaatgttggatatgcattcat |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
40158384 |
ttgcagaacaaatgtaatgttggatatgcattcat |
40158350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University