View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13968_low_13 (Length: 368)
Name: NF13968_low_13
Description: NF13968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13968_low_13 |
 |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0051 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 19 - 351
Target Start/End: Complemental strand, 10201 - 9860
Alignment:
| Q |
19 |
atcacctagggattaattnnnnnnnncacctaggactttttagtaattttgtgcactagagatagggtttagtggtagattaacctaatataagcttttt |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10201 |
atcacctagggattaattaaaaaaaacacctaggactttttagtaattttgtgcactagagatagggtttagtggtagattaacctaatataagcttttt |
10102 |
T |
 |
| Q |
119 |
caatataga-agaattgaaaaacctaatttgagtttttacactaatgaaattcttgcggcctctcaccctcttccgtcctacatctctcaatttgtcaga |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| || | ||| ||||||||||||||||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
10101 |
aaatatagggagaattgaaaaacctaatttgagtttttacatta-tcaaactcttgcggcctctcacc-tcttctgtcccacatctctcaatttgtcaga |
10004 |
T |
 |
| Q |
218 |
acgtaacgagttgcacctaatttgatcgaaacagttcatttgagaagcaagctatctcatttatttagtcgtaagtttggttaattttaatt-------- |
309 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10003 |
acgtaacgagttacacctaatttgatcgaaacagttcatttgagaagcaagctatctcatttatttagtcgtaagtttggttaattttaattctttctca |
9904 |
T |
 |
| Q |
310 |
--cttttacaaaaagagattcaatactgttcaccccttcctctt |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9903 |
ttcttttacaaaaagagattcaatactgttcacgccttcctctt |
9860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University